Deep t.Issue Therapy & Reiki

Time Science & Art FB Post bc FB Can’t Handle it. RNA sequences From The Tzolkin.

HF6

CODON                       TAA (Isoleucine)

INVCODON               AAT (Leucine)

KIN 21       C8           ACAACGUGAUGCACAACG

          Y8           UAUUACAUAAUG

S8           UCUUCCUCAUCGAGUAGCAGAAGGAGUAGCUCAUCG

N8          AAUAACUUAUUG

SC6         UAAUAGUGAAUGAUUACU

KIN22         G9          GGUGGCGGAGGGCCACCGCCUCCC

F9           UUUUUCAAAAAG

Y9           UAUUACAUAAUG

Q9          CAACAGGUUGUC

W5         ACUACCACAACGUGAUGGUGUUGC

KIN23        A10        GCUGCCGCAGCGCGACGGCGUCGC

H10        CAUCACGUAGUG

N10        AAUAACUUAUUG

Q10        CAACAGGUUGUC

Y4           UAUUACAUAAUG

KIN24        V11        GUUGUCGUAGUGCAACAGCAUCAC

R11         CGUCGCCGACGGAGAAGGGCAGCGGCUGCCUCUUCC

V11        GUUGUCGUAGUGCAACAGCAUCAC

K11         AAAAAGUUUUUC

F3           AAAAAGUUUUUCAAAAAG

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

%d bloggers like this: